MLSA Metot ve Yazılımı

MLSA veri tabanı 214Z008 projesi kapsamında oluşturulacaktır ve geliştirilen MLSA yazılımının ana elementidir. MLSA yazılımını kullanmak isteyen bir araştırmacı, analiz ettiği fungal izolatın türünü, eğer bu tür veri tabanında yer alıyor ise MLSA yazılımı ile tespit edebilecektir. MLSA veri tabanındaki tür listesi “TÜRLER” sekmesinde yer almaktadır.

MLSA ile fungal tür tespiti yapmak isteyen bir araştırmacı aşağıdaki adımları izlemelidir.

Fungi Genomik DNA İzolasyonu

Araştırmacı, Polimeraz Zincir Reaksiyonu (PCR) için yeterli miktar ve kalitede genomik DNA elde edebileceği herhangi bir DNA izolasyon yöntemini kullanabilir. İzolasyonu tamamlanmış fungal genomik DNA’nın miktarı ve kalitesi spektrofotometrik yöntemlerle ölçülerek sonraki basamaklara uygunluğu test edilmelidir. DNA izolatının OD260/OD280 oranının 1.8-2.0 OD260/OD230 oranının ise 2.0-2.2 aralığında olması örneğin saflığını gösterecektir. Yapılan izolasyon işlemleri sonrası örneklerden en az 10 ng/µl (tercihen 50-300 ng/µl) konsantrasyonuna sahip DNA elde edilmesi gerekmektedir.

Proje kapsamında fungi kültürlerinden DNA izolasyonu şu şekilde yapılmaktadır: 200 mg küf kolonisi katı besi yerinden hasat edilir, içerisinde 0,1 mm çaplı cam boncuk ve 400 µl parçalama çözeltisi (CTAB -hexadecyltrimethylammonium bromide-, TrisHCl pH 8, EDTA, NaCl) bulunan tüplere transfer edilir ve 1 dk 6000 RPMde homojenize edilir. Homojenizatör bulunmayan durumlarda 2000 rpm’de 3 dk vorteks işlemi yapılır. Yeni bir tüpe transfer edilecek numunenin üzerine 400 µl bağlama çözeltisi (Guanidine thiocyanate, Tris-HCl, pH 8) eklenir, 10 dk 95 °Cde inkübe edilir, 400 µl 2-propanol eklenir ve silika kolona yüklenir. 10000 g’de 1 dk santrifüj ile kolondan geçirilen numunedeki DNA’lar silika kolonda tutulur, daha sonra iki defa yıkama çözeltisi (NaCl, Tris-HCl, pH 8; Etanol) ile yıkanır. Silika kolon santrifügasyonla kurutulur. Silika kolonda tutulan DNA’lar 100µl nükleaz içermeyen, steril, deiyonize su (pH 7) ile kolondan alınır ve analize kadar -20 °C’de saklanır.

Hedef Genlerin DNA Dizi Analizi Öncesi Çoğaltılması

214Z008 projesi kapsamında tasarlanan veya literatürden alınan ve validasyonu gerçekleştirilen primer çiftleri, hedefleri ve DNA dizleri aşağıdaki tablolarda verilmiştir. ITS ve IGS hedefli primerler sırasıyla Conrad vd. (2012) ve Carbone ve Kohn (1999) tarafından tasarlanmıştır. Bu primerlerle gerçekleştirilecek PCR reaksiyonlarında mutlaka “proof-reading” aktivitesine sahip DNA polimerazlar kullanılmalıdır. Araştırmacı, hedeflenen gen bölgesinin DNA dizi bilgisine ulaşmak şartıyla, tablolarda verilenlerin dışında primer çiftleri de kullanabilir. PCR ile çoğaltılan bölgenin spesifikliği agaroz jelde boyut analizi ile kontrol edilebileceği gibi, kantitatif gerçek zamanlı PCR (qPCR) reaksiyonlarıyla çoğaltılan amplikonların spesifikliği 55°C - 95°C arasında gerçekleştirilecek erime eğrisi analizi ile kontrol edilebilir. Bu proje kapsamında veri bankası oluşturmak için kullanılan fungal suşlardan elde edilen PCR ürün boyutu ve erime sıcaklığı (Tm) değerleri aşağıdaki tablolarda verilmiştir.

214Z008 projesi kapsamında hedef genler qPCR reaksiyonlarıyla çoğaltılmıştır. QPCR Roche Light Cycler Nano (Roche Life Sciences, Germany) cihazı kullanılarak gerçekleştirilmiştir. Reaksiyonlar 1.5 mM MgCl2, 0.2 mM dNTP mix, 1x Reaksiyon Tamponu, 0.1U Proof Reading Hot-Start Taq DNA Polimeraz, 1x EvaGreen, 5 ng/μl kalıp DNA ve her bir primerden 0.5 μM içermektedir. Çoğalma reaksiyonu 1 döngü 95°C 3 dk, 35 döngü 20 sn 95°C, 20 sn primere özgü bağlanma sıcaklığı ve 25 sn 72°C koşullarında gerçekleştirilmiştir. QPCR sırasında sadece istenilen ürünün çoğaltıldığını belirlemek için 55°C - 95°C arasında erime eğrisi analizi yapılmıştır. QPCR sonucunda tüpte bulunan nükleotidler, floresan boyalar vb. PCR bileşenlerinin, çoğaltılmış hedef DNA’ların dizi analizi öncesi ortamdan uzaklaştırılması için qPCR ürünleri silika DNA kolonları ve 150 bç üzeri DNA’ların kolona bağlanmasını sağlayacak DNA bağlama tamponları kullanılarak saflaştırılmıştır.

Primer çifleri ve hedef tür ve genler

Hedef CinsHedef DNAPrimerPrimer
İleriGeri
AspergillusITSITS_FITS_R
PenicilliumITSITS_FITS_R
FusariumITSITS_FITS_R
ScopulariopsisITSITS_FITS_R
CladosporiumITSITS_FITS_R
AlternariaITSITS_FITS_R
DiğerITSITS_FITS_R
AspergillusEF1-αAS_EF1_FAS_EF1_R
PenicilliumEF1-αPE_EF1_FPE_EF1_R
FusariumEF1-αFU_EF1_FFU_EF1_R
ScopulariopsisEF1-αSC_EF1_FSC_EF1_R
CladosporiumEF1-αCL_EF1_FCL_EF1_R
AlternariaEF1-αAL_EF1_FAL_EF1_R
AlternariaEF1-αAL_EF1_F2AL_EF1_R2
DiğerEF1-αOT_EF1_FOT_EF1_R
DiğerEF1-αOT_EF1_F2OT_EF1_R2
Aspergillusβ-TubulinAS_TU_FAS_TU_R
Penicilliumβ-TubulinPE_TU_FPE_TU_R
Fusariumβ-TubulinFU_TU_FFU_TU_R
Scopulariopsisβ-TubulinSC_TU_FSC_TU_R
Cladosporiumβ-TubulinCL_TU_FCL_TU_R
Alternariaβ-TubulinAL_TU_FAL_TU_R
Diğerβ-TubulinOT_TU_FOT_TU_R
AspergillusCalmodulinAS_CA_FAS_CA_R
PenicilliumCalmodulinPE_CA_FPE_CA_R
FusariumCalmodulinFU_CA_FFU_CA_R
CladosporiumCalmodulinCL_CA_FCL_CA_R
AlternariaCalmodulinAL_CA_FAL_CA_R

Primer DNA Dizileri

Primer KodDNA Dizisi 5’-3’
ITS_FTCCTCCGCTTATTGATATGC
ITS_RGGAAGTAAAAGTCGTAACAAGG
AS_EF1_FCGAGGCTGGTATCTCCAAG
AS_EF1_RCATCCTGGAGGGGAAGAC
PE_EF1_FGTCACCGTGATTTCATCAAG
PE_EF1_RAGCATGTTGTCRCCGTTG
FU_EF1_FACCCAGGCGTACTTGAAGGA
FU_EF1_RTAACGTCGTCGTCATCGGC
SC_EF1_FAAGGATGGCCAGACTCGTGA
SC_EF1_RACATGGGCTTGGAGGGAA
CL_EF1_FACTCGGYAAGGGTYCCTT
CL_EF1_RGTTCTTGATGAAATCACGG
AL_EF1_FGGTGGTATCTCCAAGGATGG
AL_EF1_RGRTGACGGARACGTTCTTA
AL_EF1_F2CAT CGA GAA GTT CGA GAA GG
AL_EF1_R2TAC TTG AAG GAA CCC TTA CC
OT_EF1_FGGTGGTATCTCCAAGGATGG
OT_EF1_RGRTGACGGARACGTTCTTA
OT_EF1_F2CAT CGA GAA GTT CGA GAA GG
OT_EF1_R2TAC TTG AAG GAA CCC TTA CC
AS_TU_FAAGATCCGTGAGGAGTTCC
AS_TU_RGGAACCATGTTGACAGCCA
PE_TU_FSGKTGCTGGTAACAACTGG
PE_TU_RAAGACATCTTGAGGCCACG
FU_TU_FACAACTGGGCCAAGGGT
FU_TU_RCTTGGGGTCGARCRTCTG
SC_TU_FGTTTACTACAGGCAGAACATCTC
SC_TU_RACCCTTGGCCCAGTTGTT
CL_TU_FGAGCGCATGAACGTCTAC
CL_TU_RCTCGGCACCCTCAGTGTA
AL_TU_FTTCGGCCAGTCTGGTGCT
AL_TU_RTGCGCATCTGGTCCTCGA
OT_TU_FTGGTGGTACCGGTTCC
OT_TU_RGAGGCAGCCATCATGTT
AS_CA_FGCKWAAYAGGACAAGGATGG
AS_CA_RCTGGTCVGCCTCACRAAT
PE_CA_FAATAGGACAAGGATGGYGA
PE_CA_RCTCCTCCTCGGARTCRGTGT
FU_CA_FGAGCTTCAGGACATGATCAA
FU_CA_RAACTCACAGTCGATTCGGC
CL_CA_FTCTTCGTAAGTGACTGCCTAG
CL_CA_RACCTCGTTGATCATGTCCTG
AL_CA_FAGGACAAGGAWGGCGATG
AL_CA_RCCTCCCGGATCATCTCGT

Amplikonların Dizilenmesi

Saflaştırılan qPCR ürünleri Sanger dizileme yöntemiyle çift yönlü dizilenmelidir. Dizilerin DNA Data bankasında en çok benzer olduğu diziler NCBI BLAST (http://blast.ncbi.nlm.nih.gov/) programı kullanılarak belirlenmelidir. Antisense DNA zincirinin ters komplementeri alınarak, Clustal Omega vb. hizalama programlarıyla sense DNA zinciri ile hizalanmalıdır. Sense ve antisense DNA zincirinin uyuşmazlık gösterdiği DNA bazları elde edilmeyene dek DNA dizilime çalışmalarına devam edilmelidir. DNA dizi analizi sonucunda yüksek güvenilirlikle elde edilen sense DNA zinciri üzerinde, çoğaltımın yapıldığı primer dizileri, Clustal Omega (www.ebi.ac.uk) programının yardımıyla belirlenip, DNA dizisinden çıkartılmalıdır. Veri bankasına primer dizileri ayıklanmış lokus dizileri girilmelidir.

MLSA Veri Tabanı Kullanılarak Tür Tayin

1. www.mlsafungi.com adresine gidilir. Web sitesinde “YAZILIMLAR” sekmesine tıklanır ve açılan sayfada yer alan bağlantılardan “MLSA Veri Bankası Entegre Edici”, “MEGA 6” ve “MLSA Tür Belirleme” yazılımları indirilir.

2. “MLSA Veri Bankası Entegre Edici” yazılımı açılır. Açılan sayfada yer alan kutucuklara, kutucuklarda belirtilen lokus isimleriyle uyumlu DNA dizileri “kopyala ve yapıştır” komutlarıyla girilir.

3. “Suş Adı” kısmına, MLSA lokus bilgileri girilen suşun adı yazılır.

4. İlgili tüm kutucuklara DNA dizisi ve suş ismi girildikten sonra, “Onay” tuşuna basılarak işlem başlatılır.

5. Açılan “Kaydet” penceresinde, dosyanın kayıt edileceği dizin seçilir ve dosyaya isim verilir.

6. Oluşturulan dosya “Notepad” “Microsoft Word” gibi bir “Text Editor” yardımıyla açılır, ve dosyadaki tüm veriler “Ctrl A ve ardından Ctrl C” komutlarıyla veya diğer yöntemlerle seçilirek kopyalanır.

7. “MEGA 6” yazılımı açılır. “Align”→”Edit/Build Alignment”→”Create New Alignment” →”OK” →”DNA” sekmeleri/tuşları seçilerek “DNA Sequences” sayfası açılır. Bu sayfaya “Ctr V” komutuyla, daha önce kopyalanan veriler yapıştırılır.

8. “Alignment” →”Align by ClustalW” →”OK” sekmeleri seçilerek hizalama başlatılır.

9. “Some squences are too divergent to be aligned” uyarısı çıktığında “Ignore” tuşuna basılır.

10. Elde edilen hizalama dosyası “Save” tuşuna basılarak, kullanıcının belirlediği bir dizine kayıt edilir.

11. MEGA 6 yazılımı kapatılır ve sonra tekrar açılır. “Distance” →”Compute Pairwise Distances” sekmeleri seçildikten sonra, program veri girdisini sağlayacak dosyayı kullanıcının seçmesini talep edecektir. Bu durumda 10. adımda kayıt edilen hizalama dosyası seçilir.

12. “Compute” komutuna basılınca, yazılım uzaklıkları hesaplayarak bir uzaklık matrisi oluşturacaktır. Bu matrisi kayıt etmek için “File” →”Export/Print Distances” sekmeleri seçilir. Açılan pencerede “Output Format” olarak “Unformatted Text” seçilir ve daha sonra “Print/Save Matrix” tuşuna basılır.

13. Açılan pencerede “Save” tuşuna basılarak, oluşturulan dosya, kullanıcının belirlediği dizine, kullanıcının belirlediği isimle girilir.

14. “MLSA Tür Belirleme” yazılımı açılır. Yazılımda “Dosya Aç” butonuna basılır, 13. adımda oluşturulan uzaklık matris dosyası seçilir ve “aç” tuşuna basılır.

15. Program üzerinde “Analiz” tuşuna basılır ve analiz edilen suş ile ilgilli sonuç sayfası elde edilir.

16. Analiz edilen suşun, veri bankasında bulunan diğer suşlarla uzaklıklarını gösteren dendrogramlar elde edilmek istendiğinde “MEGA 6” yazılımı tekrar açılır. “Phylogeny” →”Construct/test Maximum Likelihood Tree” sekmeleri seçilir. Dosya seçim penceresi açıldığında, 10. adımda kayıt edilen hizalama dosyası seçilir, “Compute” tuşuna basılır ve dendrogram çizilir.